COVID-19 Records

Gates Package — page 836

of 1375 pages

← p.835 p.837 → · this page in the original PDF · package

B LCR TGACCA. 118-113 HDAd-PGK.ABE8e and HDAd-EF 1a.ABE8e ITR [e) after base editing v TGACCAATAG TGGCCGATSG TesccccTes TGGCCGATAG [pa TR ull bGHpA I msamt PGK JIR > U6 I sgRNA Bese -- [MIRNENAN] 6-2UTR [sv40pa}-/m mmm -113A>G B nes indels £5 H 20 Be £8 So oN"So "tS SS S$ e Une HP & Xe oe ee & Fig.1 HDAd-EF 1a.ABE8e v& 3 days O®BG/BCNU Y 18 days + --_--_--_--_----> 4.8 kb Allele sequence CCAGCCTIGCCTTGACCAMPAGCCTTGACAAGGCAAACTT ceasccrracerteaccd sRacccTTGACAAGGCAAACT? ceaccerzacereccn}sfroscorteAcAAGGCAARCT? ceascerreccrreecr|qfracccrscAcaAGGCARACTT ceacccrzacereccafdroscorteacAAGGCAAACT? dpoccorzcacaacccanactt ccaeccrreccT Teac. CCAGCCTIGCCTIGECCHAPGGCCTTGACAAGGCAAACTT ~28% -113A>G +4 + CD34+ cells + erythroid differentiation y % editing > % -113A>G conversion o 8 & 88 % editing # of reads 214652 39179 26871 11627 & of reads 20) +19 a5) Bed e2220209000 oun 154M 25M 35M

This is our OCR of the page, with running headers and footers removed. The Committee's PDF is authoritative; quote from it. Machine-readable, including the uncleaned text: /api/page/gates/836

Records on this page

RecordDateTypePages
gates:exh:00276 attachment 836